Review



pirak4  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc pirak4
    Pirak4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 75 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Phospho-IRAK4+(Thr345%2FSer346)+Rabbit+mAb/pm41477766-341-13-15
    Average 93 stars, based on 75 article reviews
    pirak4 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Endogenously produced itaconate negatively regulates innate-driven cytokine production and drives global ubiquitination in human macrophages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Supersignal West Femto maximum Sensitivity Substrate Thermo Fisher scientific Cat. #34096 Blotting-grade Blocker Bio-Rad Laboratories Cat. #1706404 Trypsin Promega Cat. #V5111 Protein A tips Agilent Cat. #G5496-60000 0.1% TFA in water Burdick & Jackson Cat. #LC485-1 0.1% formic acid in water Thermo Fisher scientific Cat. #LS118-4 0.1% formic acid in acetonitrile Thermo Fisher scientific Cat. #LS120-4 3% acetonitrile in water Thermo Fisher scientific Cat. #A996-4 Streptavidin tips Agilent Technologies Cat. #G5496-60010 20% acetonitrile Fisher chemical Cat. #A996-4 20% acetic acid EMD Cat. #AX0073-6 Lymphoprep Stemcell Technologies Cat. # 07811 Human CD14 Microbeads MACS Cat. #130-050-201 Critical Commercial assays Pierce BCA protein assay Kit Thermo Fisher scientific Cat. #23225 4-15% Tris-HCl gels Bio-Rad Laboratories Cat. #3450029 Nitrocellulose membranes Bio-Rad Laboratories Cat. #1704159 QIAshredder Kit Qiagen Cat. #79656 RNeasy Kit Qiagen Cat. #74104 cDNA reverse transcription Kit Applied Biosystems Cat. #4368814 Taqman Fast Advanced master mix Applied Biosystems Cat. #4444557 Human TNFa Taqman probe Invitrogen Cat. #Hs00174128 Human IFNb Taqman probe Invitrogen Cat. #Hs01077958 Human IL-6 Taqman probe Invitrogen Cat. #Hs00174131 Human IL-1b Taqman Probe Invitrogen Cat. #Hs01555410 Human ACOD1 Taqman Probe Invitrogen Cat. #Hs00985781 Human CXCL10 Taqman Probe Invitrogen Cat. #Hs00171042 Human GAPDH Taqman Probe Applied Biosystems Cat. #4310884E TNFa Human DuoSet ELISA Kit R&D Systems Cat. #DY210-05 IL-1b Human DuoSet ELISA Kit R&D Systems Cat. #DY201-05 IL-6 Human DuoSet ELISA Kit R&D Systems Cat. #DY206-05 IFNb Human DuoSet ELISA Kit R&D Systems Cat. #DY814-05 CXCL10 Human DuoSet ELISA Kit R&D Systems Cat. #DY266-05 Cell Line Nucleofector Kit V Lonza Cat. #VCA-1003 Experimental Models: Cell Lines THP-1 Cells ATCC Cat. #TIB-202 IRG1 KO THP-1 Cells This Paper N/A IRF3 KO THP-1 Cells Invivogen Cat. #thpd-koirf3 Deposited Data Proteomics Data ProteomeXchange PXD053956 RNA Sequencing Data GEO GSE272396 Oligonucleotides IRG1 crRNA: UAUGUGAAACACUUCCGUAGGUUUUAGAGCUAUGCU This Paper N/A Human RPS13 F CGAAAGCATCTTGAGAGGAACA Applied Biosystems N/A Human RPS13 R TCGAGCCAAACGGTGAATC Applied Biosystems N/A Human HMOX1 F CCCACGCCTACACCCGCTAC Applied Biosystems N/A (Continued on next page) Cell Reports 43, 114570, August 27, 2024 17

    Saline:

    Article Title: Endogenously produced itaconate negatively regulates innate-driven cytokine production and drives global ubiquitination in human macrophages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Supersignal West Femto maximum Sensitivity Substrate Thermo Fisher scientific Cat. #34096 Blotting-grade Blocker Bio-Rad Laboratories Cat. #1706404 Trypsin Promega Cat. #V5111 Protein A tips Agilent Cat. #G5496-60000 0.1% TFA in water Burdick & Jackson Cat. #LC485-1 0.1% formic acid in water Thermo Fisher scientific Cat. #LS118-4 0.1% formic acid in acetonitrile Thermo Fisher scientific Cat. #LS120-4 3% acetonitrile in water Thermo Fisher scientific Cat. #A996-4 Streptavidin tips Agilent Technologies Cat. #G5496-60010 20% acetonitrile Fisher chemical Cat. #A996-4 20% acetic acid EMD Cat. #AX0073-6 Lymphoprep Stemcell Technologies Cat. # 07811 Human CD14 Microbeads MACS Cat. #130-050-201 Critical Commercial assays Pierce BCA protein assay Kit Thermo Fisher scientific Cat. #23225 4-15% Tris-HCl gels Bio-Rad Laboratories Cat. #3450029 Nitrocellulose membranes Bio-Rad Laboratories Cat. #1704159 QIAshredder Kit Qiagen Cat. #79656 RNeasy Kit Qiagen Cat. #74104 cDNA reverse transcription Kit Applied Biosystems Cat. #4368814 Taqman Fast Advanced master mix Applied Biosystems Cat. #4444557 Human TNFa Taqman probe Invitrogen Cat. #Hs00174128 Human IFNb Taqman probe Invitrogen Cat. #Hs01077958 Human IL-6 Taqman probe Invitrogen Cat. #Hs00174131 Human IL-1b Taqman Probe Invitrogen Cat. #Hs01555410 Human ACOD1 Taqman Probe Invitrogen Cat. #Hs00985781 Human CXCL10 Taqman Probe Invitrogen Cat. #Hs00171042 Human GAPDH Taqman Probe Applied Biosystems Cat. #4310884E TNFa Human DuoSet ELISA Kit R&D Systems Cat. #DY210-05 IL-1b Human DuoSet ELISA Kit R&D Systems Cat. #DY201-05 IL-6 Human DuoSet ELISA Kit R&D Systems Cat. #DY206-05 IFNb Human DuoSet ELISA Kit R&D Systems Cat. #DY814-05 CXCL10 Human DuoSet ELISA Kit R&D Systems Cat. #DY266-05 Cell Line Nucleofector Kit V Lonza Cat. #VCA-1003 Experimental Models: Cell Lines THP-1 Cells ATCC Cat. #TIB-202 IRG1 KO THP-1 Cells This Paper N/A IRF3 KO THP-1 Cells Invivogen Cat. #thpd-koirf3 Deposited Data Proteomics Data ProteomeXchange PXD053956 RNA Sequencing Data GEO GSE272396 Oligonucleotides IRG1 crRNA: UAUGUGAAACACUUCCGUAGGUUUUAGAGCUAUGCU This Paper N/A Human RPS13 F CGAAAGCATCTTGAGAGGAACA Applied Biosystems N/A Human RPS13 R TCGAGCCAAACGGTGAATC Applied Biosystems N/A Human HMOX1 F CCCACGCCTACACCCGCTAC Applied Biosystems N/A (Continued on next page) Cell Reports 43, 114570, August 27, 2024 17

    Control:

    Article Title: Endogenously produced itaconate negatively regulates innate-driven cytokine production and drives global ubiquitination in human macrophages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Supersignal West Femto maximum Sensitivity Substrate Thermo Fisher scientific Cat. #34096 Blotting-grade Blocker Bio-Rad Laboratories Cat. #1706404 Trypsin Promega Cat. #V5111 Protein A tips Agilent Cat. #G5496-60000 0.1% TFA in water Burdick & Jackson Cat. #LC485-1 0.1% formic acid in water Thermo Fisher scientific Cat. #LS118-4 0.1% formic acid in acetonitrile Thermo Fisher scientific Cat. #LS120-4 3% acetonitrile in water Thermo Fisher scientific Cat. #A996-4 Streptavidin tips Agilent Technologies Cat. #G5496-60010 20% acetonitrile Fisher chemical Cat. #A996-4 20% acetic acid EMD Cat. #AX0073-6 Lymphoprep Stemcell Technologies Cat. # 07811 Human CD14 Microbeads MACS Cat. #130-050-201 Critical Commercial assays Pierce BCA protein assay Kit Thermo Fisher scientific Cat. #23225 4-15% Tris-HCl gels Bio-Rad Laboratories Cat. #3450029 Nitrocellulose membranes Bio-Rad Laboratories Cat. #1704159 QIAshredder Kit Qiagen Cat. #79656 RNeasy Kit Qiagen Cat. #74104 cDNA reverse transcription Kit Applied Biosystems Cat. #4368814 Taqman Fast Advanced master mix Applied Biosystems Cat. #4444557 Human TNFa Taqman probe Invitrogen Cat. #Hs00174128 Human IFNb Taqman probe Invitrogen Cat. #Hs01077958 Human IL-6 Taqman probe Invitrogen Cat. #Hs00174131 Human IL-1b Taqman Probe Invitrogen Cat. #Hs01555410 Human ACOD1 Taqman Probe Invitrogen Cat. #Hs00985781 Human CXCL10 Taqman Probe Invitrogen Cat. #Hs00171042 Human GAPDH Taqman Probe Applied Biosystems Cat. #4310884E TNFa Human DuoSet ELISA Kit R&D Systems Cat. #DY210-05 IL-1b Human DuoSet ELISA Kit R&D Systems Cat. #DY201-05 IL-6 Human DuoSet ELISA Kit R&D Systems Cat. #DY206-05 IFNb Human DuoSet ELISA Kit R&D Systems Cat. #DY814-05 CXCL10 Human DuoSet ELISA Kit R&D Systems Cat. #DY266-05 Cell Line Nucleofector Kit V Lonza Cat. #VCA-1003 Experimental Models: Cell Lines THP-1 Cells ATCC Cat. #TIB-202 IRG1 KO THP-1 Cells This Paper N/A IRF3 KO THP-1 Cells Invivogen Cat. #thpd-koirf3 Deposited Data Proteomics Data ProteomeXchange PXD053956 RNA Sequencing Data GEO GSE272396 Oligonucleotides IRG1 crRNA: UAUGUGAAACACUUCCGUAGGUUUUAGAGCUAUGCU This Paper N/A Human RPS13 F CGAAAGCATCTTGAGAGGAACA Applied Biosystems N/A Human RPS13 R TCGAGCCAAACGGTGAATC Applied Biosystems N/A Human HMOX1 F CCCACGCCTACACCCGCTAC Applied Biosystems N/A (Continued on next page) Cell Reports 43, 114570, August 27, 2024 17

    Lysis:

    Article Title: Endogenously produced itaconate negatively regulates innate-driven cytokine production and drives global ubiquitination in human macrophages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Supersignal West Femto maximum Sensitivity Substrate Thermo Fisher scientific Cat. #34096 Blotting-grade Blocker Bio-Rad Laboratories Cat. #1706404 Trypsin Promega Cat. #V5111 Protein A tips Agilent Cat. #G5496-60000 0.1% TFA in water Burdick & Jackson Cat. #LC485-1 0.1% formic acid in water Thermo Fisher scientific Cat. #LS118-4 0.1% formic acid in acetonitrile Thermo Fisher scientific Cat. #LS120-4 3% acetonitrile in water Thermo Fisher scientific Cat. #A996-4 Streptavidin tips Agilent Technologies Cat. #G5496-60010 20% acetonitrile Fisher chemical Cat. #A996-4 20% acetic acid EMD Cat. #AX0073-6 Lymphoprep Stemcell Technologies Cat. # 07811 Human CD14 Microbeads MACS Cat. #130-050-201 Critical Commercial assays Pierce BCA protein assay Kit Thermo Fisher scientific Cat. #23225 4-15% Tris-HCl gels Bio-Rad Laboratories Cat. #3450029 Nitrocellulose membranes Bio-Rad Laboratories Cat. #1704159 QIAshredder Kit Qiagen Cat. #79656 RNeasy Kit Qiagen Cat. #74104 cDNA reverse transcription Kit Applied Biosystems Cat. #4368814 Taqman Fast Advanced master mix Applied Biosystems Cat. #4444557 Human TNFa Taqman probe Invitrogen Cat. #Hs00174128 Human IFNb Taqman probe Invitrogen Cat. #Hs01077958 Human IL-6 Taqman probe Invitrogen Cat. #Hs00174131 Human IL-1b Taqman Probe Invitrogen Cat. #Hs01555410 Human ACOD1 Taqman Probe Invitrogen Cat. #Hs00985781 Human CXCL10 Taqman Probe Invitrogen Cat. #Hs00171042 Human GAPDH Taqman Probe Applied Biosystems Cat. #4310884E TNFa Human DuoSet ELISA Kit R&D Systems Cat. #DY210-05 IL-1b Human DuoSet ELISA Kit R&D Systems Cat. #DY201-05 IL-6 Human DuoSet ELISA Kit R&D Systems Cat. #DY206-05 IFNb Human DuoSet ELISA Kit R&D Systems Cat. #DY814-05 CXCL10 Human DuoSet ELISA Kit R&D Systems Cat. #DY266-05 Cell Line Nucleofector Kit V Lonza Cat. #VCA-1003 Experimental Models: Cell Lines THP-1 Cells ATCC Cat. #TIB-202 IRG1 KO THP-1 Cells This Paper N/A IRF3 KO THP-1 Cells Invivogen Cat. #thpd-koirf3 Deposited Data Proteomics Data ProteomeXchange PXD053956 RNA Sequencing Data GEO GSE272396 Oligonucleotides IRG1 crRNA: UAUGUGAAACACUUCCGUAGGUUUUAGAGCUAUGCU This Paper N/A Human RPS13 F CGAAAGCATCTTGAGAGGAACA Applied Biosystems N/A Human RPS13 R TCGAGCCAAACGGTGAATC Applied Biosystems N/A Human HMOX1 F CCCACGCCTACACCCGCTAC Applied Biosystems N/A (Continued on next page) Cell Reports 43, 114570, August 27, 2024 17



    Similar Products

    gifu 11927  (ATCC)
    92
    ATCC gifu 11927
    Gifu 11927, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Bradyrhizobium+japonicum+(Buchanan)+Jordan/10__36346_slash_sarjpm__2025__v06i04__001-223-14-28
    Average 92 stars, based on 1 article reviews
    gifu 11927 - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    pirak4  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc pirak4
    Pirak4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Phospho-IRAK4+(Thr345%2FSer346)+Rabbit+mAb/pm41477766-341-13-15
    Average 93 stars, based on 1 article reviews
    pirak4 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    p thr345 ser346 irak4  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc p thr345 ser346 irak4
    a , Kinome screen for a single dose of TMA (0.1 mM) against 456 kinases. The kinases covered by the kinome scan assay are visualized using a phylogenetic layout. Preliminary positive hits with potential binding >35% vs control (DMSO) are represented by a red dot; non-binding kinases are represented by a green dot. Kinase group names: TK, tyrosine kinases; TKL, tyrosine kinase-like; STE, STE kinase group; CK1, cell linase 1; AGC, protein kinase A, G and C families; CAMK, calcium and calmodulin-regulated kinases; CMGC, CMGC kinase group. b , Functional characterization of the inhibition of <t>IRAK4</t> by TMA. IRAK4 phosphorylation activity was determined in the presence of various concentrations of TMA and resulted in an IC 50 of 3.4 µM. c , d , TMA preincubation (100 µM for 30 min) suppresses LPS-induced (1 µg ml −1 , 4 h) IL-6 ( c ) and TNF ( d ) release by human PBMCs. The values of the unstimulated controls were arbitrarily set to 1. For c and d , statistical significance ( P < 0.05) was assessed with a two-sided unpaired Student’s t- test (vs LPS-stimulated control). e , TMA (100 μM) or the IRAK4-specific inhibitor PF06650833 (50 nM) do not inhibit TNF secretion from human PBMCs after 4 h stimulation with PMA (50 ng ml −1 ) and ionomycin (1 μg ml −1 ). f , Impact of TMA pre-treatment (100 µM, 30 min) on human PBMCs’ Thr209 IRAK1/IRAK1 phosphorylation upon LPS (1 µg ml −1 ) stimulation for the indicated times. g , Human PBMCs were pre-treated (for 30 min) with the indicated concentrations of TMA, and Thr209 IRAK1/IRAK1 phosporylation was assessed after 10 min of LPS (1 μg ml −1 ) challenge. The time-dependent ( h ) and dose-dependent ( i ) effect of TMA on phosphorylation of Ser536 NF-κBp65/NF-κBp65 of human PBMCs stimulated with LPS (1 μg ml −1 ) was assessed as in f and g . For f – i , the control value was arbitrarily set to 1, and statistical significance ( P < 0.05) was assessed with a one-sided unpaired Student’s t- test. For PBMC experiments in c – i , each data point represents a separate experiment. j , A 24 h Kaplan–Meier survival curve of mice challenged with a lethal dose of LPS (30 mg kg −1 ) that received a single dose of TMA (59 mg kg −1 , red line), or vehicle (black line); * P = 0.0047 determined by two-sided log-rank Mantel–Cox test. Data are means; error bars, s.e.m.
    P Thr345 Ser346 Irak4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Phospho-IRAK4+(Thr345%2FSer346)+Rabbit+mAb/pmc12727497-215-9-37
    Average 93 stars, based on 1 article reviews
    p thr345 ser346 irak4 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    phospho irak4  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc phospho irak4
    a , Kinome screen for a single dose of TMA (0.1 mM) against 456 kinases. The kinases covered by the kinome scan assay are visualized using a phylogenetic layout. Preliminary positive hits with potential binding >35% vs control (DMSO) are represented by a red dot; non-binding kinases are represented by a green dot. Kinase group names: TK, tyrosine kinases; TKL, tyrosine kinase-like; STE, STE kinase group; CK1, cell linase 1; AGC, protein kinase A, G and C families; CAMK, calcium and calmodulin-regulated kinases; CMGC, CMGC kinase group. b , Functional characterization of the inhibition of <t>IRAK4</t> by TMA. IRAK4 phosphorylation activity was determined in the presence of various concentrations of TMA and resulted in an IC 50 of 3.4 µM. c , d , TMA preincubation (100 µM for 30 min) suppresses LPS-induced (1 µg ml −1 , 4 h) IL-6 ( c ) and TNF ( d ) release by human PBMCs. The values of the unstimulated controls were arbitrarily set to 1. For c and d , statistical significance ( P < 0.05) was assessed with a two-sided unpaired Student’s t- test (vs LPS-stimulated control). e , TMA (100 μM) or the IRAK4-specific inhibitor PF06650833 (50 nM) do not inhibit TNF secretion from human PBMCs after 4 h stimulation with PMA (50 ng ml −1 ) and ionomycin (1 μg ml −1 ). f , Impact of TMA pre-treatment (100 µM, 30 min) on human PBMCs’ Thr209 IRAK1/IRAK1 phosphorylation upon LPS (1 µg ml −1 ) stimulation for the indicated times. g , Human PBMCs were pre-treated (for 30 min) with the indicated concentrations of TMA, and Thr209 IRAK1/IRAK1 phosporylation was assessed after 10 min of LPS (1 μg ml −1 ) challenge. The time-dependent ( h ) and dose-dependent ( i ) effect of TMA on phosphorylation of Ser536 NF-κBp65/NF-κBp65 of human PBMCs stimulated with LPS (1 μg ml −1 ) was assessed as in f and g . For f – i , the control value was arbitrarily set to 1, and statistical significance ( P < 0.05) was assessed with a one-sided unpaired Student’s t- test. For PBMC experiments in c – i , each data point represents a separate experiment. j , A 24 h Kaplan–Meier survival curve of mice challenged with a lethal dose of LPS (30 mg kg −1 ) that received a single dose of TMA (59 mg kg −1 , red line), or vehicle (black line); * P = 0.0047 determined by two-sided log-rank Mantel–Cox test. Data are means; error bars, s.e.m.
    Phospho Irak4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Phospho-IRAK4+(Thr345%2FSer346)+Rabbit+mAb/pmc12616249-141-21-27
    Average 93 stars, based on 1 article reviews
    phospho irak4 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    anti pirak4 thr345 ser346  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc anti pirak4 thr345 ser346
    a , Kinome screen for a single dose of TMA (0.1 mM) against 456 kinases. The kinases covered by the kinome scan assay are visualized using a phylogenetic layout. Preliminary positive hits with potential binding >35% vs control (DMSO) are represented by a red dot; non-binding kinases are represented by a green dot. Kinase group names: TK, tyrosine kinases; TKL, tyrosine kinase-like; STE, STE kinase group; CK1, cell linase 1; AGC, protein kinase A, G and C families; CAMK, calcium and calmodulin-regulated kinases; CMGC, CMGC kinase group. b , Functional characterization of the inhibition of <t>IRAK4</t> by TMA. IRAK4 phosphorylation activity was determined in the presence of various concentrations of TMA and resulted in an IC 50 of 3.4 µM. c , d , TMA preincubation (100 µM for 30 min) suppresses LPS-induced (1 µg ml −1 , 4 h) IL-6 ( c ) and TNF ( d ) release by human PBMCs. The values of the unstimulated controls were arbitrarily set to 1. For c and d , statistical significance ( P < 0.05) was assessed with a two-sided unpaired Student’s t- test (vs LPS-stimulated control). e , TMA (100 μM) or the IRAK4-specific inhibitor PF06650833 (50 nM) do not inhibit TNF secretion from human PBMCs after 4 h stimulation with PMA (50 ng ml −1 ) and ionomycin (1 μg ml −1 ). f , Impact of TMA pre-treatment (100 µM, 30 min) on human PBMCs’ Thr209 IRAK1/IRAK1 phosphorylation upon LPS (1 µg ml −1 ) stimulation for the indicated times. g , Human PBMCs were pre-treated (for 30 min) with the indicated concentrations of TMA, and Thr209 IRAK1/IRAK1 phosporylation was assessed after 10 min of LPS (1 μg ml −1 ) challenge. The time-dependent ( h ) and dose-dependent ( i ) effect of TMA on phosphorylation of Ser536 NF-κBp65/NF-κBp65 of human PBMCs stimulated with LPS (1 μg ml −1 ) was assessed as in f and g . For f – i , the control value was arbitrarily set to 1, and statistical significance ( P < 0.05) was assessed with a one-sided unpaired Student’s t- test. For PBMC experiments in c – i , each data point represents a separate experiment. j , A 24 h Kaplan–Meier survival curve of mice challenged with a lethal dose of LPS (30 mg kg −1 ) that received a single dose of TMA (59 mg kg −1 , red line), or vehicle (black line); * P = 0.0047 determined by two-sided log-rank Mantel–Cox test. Data are means; error bars, s.e.m.
    Anti Pirak4 Thr345 Ser346, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Phospho-IRAK4+(Thr345%2FSer346)+Rabbit+mAb/us12448385-1508-12-14
    Average 93 stars, based on 1 article reviews
    anti pirak4 thr345 ser346 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    phosphor irak4  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc phosphor irak4
    a , Kinome screen for a single dose of TMA (0.1 mM) against 456 kinases. The kinases covered by the kinome scan assay are visualized using a phylogenetic layout. Preliminary positive hits with potential binding >35% vs control (DMSO) are represented by a red dot; non-binding kinases are represented by a green dot. Kinase group names: TK, tyrosine kinases; TKL, tyrosine kinase-like; STE, STE kinase group; CK1, cell linase 1; AGC, protein kinase A, G and C families; CAMK, calcium and calmodulin-regulated kinases; CMGC, CMGC kinase group. b , Functional characterization of the inhibition of <t>IRAK4</t> by TMA. IRAK4 phosphorylation activity was determined in the presence of various concentrations of TMA and resulted in an IC 50 of 3.4 µM. c , d , TMA preincubation (100 µM for 30 min) suppresses LPS-induced (1 µg ml −1 , 4 h) IL-6 ( c ) and TNF ( d ) release by human PBMCs. The values of the unstimulated controls were arbitrarily set to 1. For c and d , statistical significance ( P < 0.05) was assessed with a two-sided unpaired Student’s t- test (vs LPS-stimulated control). e , TMA (100 μM) or the IRAK4-specific inhibitor PF06650833 (50 nM) do not inhibit TNF secretion from human PBMCs after 4 h stimulation with PMA (50 ng ml −1 ) and ionomycin (1 μg ml −1 ). f , Impact of TMA pre-treatment (100 µM, 30 min) on human PBMCs’ Thr209 IRAK1/IRAK1 phosphorylation upon LPS (1 µg ml −1 ) stimulation for the indicated times. g , Human PBMCs were pre-treated (for 30 min) with the indicated concentrations of TMA, and Thr209 IRAK1/IRAK1 phosporylation was assessed after 10 min of LPS (1 μg ml −1 ) challenge. The time-dependent ( h ) and dose-dependent ( i ) effect of TMA on phosphorylation of Ser536 NF-κBp65/NF-κBp65 of human PBMCs stimulated with LPS (1 μg ml −1 ) was assessed as in f and g . For f – i , the control value was arbitrarily set to 1, and statistical significance ( P < 0.05) was assessed with a one-sided unpaired Student’s t- test. For PBMC experiments in c – i , each data point represents a separate experiment. j , A 24 h Kaplan–Meier survival curve of mice challenged with a lethal dose of LPS (30 mg kg −1 ) that received a single dose of TMA (59 mg kg −1 , red line), or vehicle (black line); * P = 0.0047 determined by two-sided log-rank Mantel–Cox test. Data are means; error bars, s.e.m.
    Phosphor Irak4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Phospho-IRAK4+(Thr345%2FSer346)+Rabbit+mAb/us12391646-185-24-72
    Average 93 stars, based on 1 article reviews
    phosphor irak4 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    phospho irak4 t345 s346  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc phospho irak4 t345 s346
    a , Kinome screen for a single dose of TMA (0.1 mM) against 456 kinases. The kinases covered by the kinome scan assay are visualized using a phylogenetic layout. Preliminary positive hits with potential binding >35% vs control (DMSO) are represented by a red dot; non-binding kinases are represented by a green dot. Kinase group names: TK, tyrosine kinases; TKL, tyrosine kinase-like; STE, STE kinase group; CK1, cell linase 1; AGC, protein kinase A, G and C families; CAMK, calcium and calmodulin-regulated kinases; CMGC, CMGC kinase group. b , Functional characterization of the inhibition of <t>IRAK4</t> by TMA. IRAK4 phosphorylation activity was determined in the presence of various concentrations of TMA and resulted in an IC 50 of 3.4 µM. c , d , TMA preincubation (100 µM for 30 min) suppresses LPS-induced (1 µg ml −1 , 4 h) IL-6 ( c ) and TNF ( d ) release by human PBMCs. The values of the unstimulated controls were arbitrarily set to 1. For c and d , statistical significance ( P < 0.05) was assessed with a two-sided unpaired Student’s t- test (vs LPS-stimulated control). e , TMA (100 μM) or the IRAK4-specific inhibitor PF06650833 (50 nM) do not inhibit TNF secretion from human PBMCs after 4 h stimulation with PMA (50 ng ml −1 ) and ionomycin (1 μg ml −1 ). f , Impact of TMA pre-treatment (100 µM, 30 min) on human PBMCs’ Thr209 IRAK1/IRAK1 phosphorylation upon LPS (1 µg ml −1 ) stimulation for the indicated times. g , Human PBMCs were pre-treated (for 30 min) with the indicated concentrations of TMA, and Thr209 IRAK1/IRAK1 phosporylation was assessed after 10 min of LPS (1 μg ml −1 ) challenge. The time-dependent ( h ) and dose-dependent ( i ) effect of TMA on phosphorylation of Ser536 NF-κBp65/NF-κBp65 of human PBMCs stimulated with LPS (1 μg ml −1 ) was assessed as in f and g . For f – i , the control value was arbitrarily set to 1, and statistical significance ( P < 0.05) was assessed with a one-sided unpaired Student’s t- test. For PBMC experiments in c – i , each data point represents a separate experiment. j , A 24 h Kaplan–Meier survival curve of mice challenged with a lethal dose of LPS (30 mg kg −1 ) that received a single dose of TMA (59 mg kg −1 , red line), or vehicle (black line); * P = 0.0047 determined by two-sided log-rank Mantel–Cox test. Data are means; error bars, s.e.m.
    Phospho Irak4 T345 S346, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Phospho-IRAK4+(Thr345%2FSer346)+Rabbit+mAb/bio_rxiv__2025__06__19__660202-257-41-44
    Average 93 stars, based on 1 article reviews
    phospho irak4 t345 s346 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    p irak4  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc p irak4
    a , Kinome screen for a single dose of TMA (0.1 mM) against 456 kinases. The kinases covered by the kinome scan assay are visualized using a phylogenetic layout. Preliminary positive hits with potential binding >35% vs control (DMSO) are represented by a red dot; non-binding kinases are represented by a green dot. Kinase group names: TK, tyrosine kinases; TKL, tyrosine kinase-like; STE, STE kinase group; CK1, cell linase 1; AGC, protein kinase A, G and C families; CAMK, calcium and calmodulin-regulated kinases; CMGC, CMGC kinase group. b , Functional characterization of the inhibition of <t>IRAK4</t> by TMA. IRAK4 phosphorylation activity was determined in the presence of various concentrations of TMA and resulted in an IC 50 of 3.4 µM. c , d , TMA preincubation (100 µM for 30 min) suppresses LPS-induced (1 µg ml −1 , 4 h) IL-6 ( c ) and TNF ( d ) release by human PBMCs. The values of the unstimulated controls were arbitrarily set to 1. For c and d , statistical significance ( P < 0.05) was assessed with a two-sided unpaired Student’s t- test (vs LPS-stimulated control). e , TMA (100 μM) or the IRAK4-specific inhibitor PF06650833 (50 nM) do not inhibit TNF secretion from human PBMCs after 4 h stimulation with PMA (50 ng ml −1 ) and ionomycin (1 μg ml −1 ). f , Impact of TMA pre-treatment (100 µM, 30 min) on human PBMCs’ Thr209 IRAK1/IRAK1 phosphorylation upon LPS (1 µg ml −1 ) stimulation for the indicated times. g , Human PBMCs were pre-treated (for 30 min) with the indicated concentrations of TMA, and Thr209 IRAK1/IRAK1 phosporylation was assessed after 10 min of LPS (1 μg ml −1 ) challenge. The time-dependent ( h ) and dose-dependent ( i ) effect of TMA on phosphorylation of Ser536 NF-κBp65/NF-κBp65 of human PBMCs stimulated with LPS (1 μg ml −1 ) was assessed as in f and g . For f – i , the control value was arbitrarily set to 1, and statistical significance ( P < 0.05) was assessed with a one-sided unpaired Student’s t- test. For PBMC experiments in c – i , each data point represents a separate experiment. j , A 24 h Kaplan–Meier survival curve of mice challenged with a lethal dose of LPS (30 mg kg −1 ) that received a single dose of TMA (59 mg kg −1 , red line), or vehicle (black line); * P = 0.0047 determined by two-sided log-rank Mantel–Cox test. Data are means; error bars, s.e.m.
    P Irak4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/11927s/Phospho-IRAK4+(Thr345%2FSer346)+Rabbit+mAb/pmc12192866-119-57-64
    Average 93 stars, based on 1 article reviews
    p irak4 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    a , Kinome screen for a single dose of TMA (0.1 mM) against 456 kinases. The kinases covered by the kinome scan assay are visualized using a phylogenetic layout. Preliminary positive hits with potential binding >35% vs control (DMSO) are represented by a red dot; non-binding kinases are represented by a green dot. Kinase group names: TK, tyrosine kinases; TKL, tyrosine kinase-like; STE, STE kinase group; CK1, cell linase 1; AGC, protein kinase A, G and C families; CAMK, calcium and calmodulin-regulated kinases; CMGC, CMGC kinase group. b , Functional characterization of the inhibition of IRAK4 by TMA. IRAK4 phosphorylation activity was determined in the presence of various concentrations of TMA and resulted in an IC 50 of 3.4 µM. c , d , TMA preincubation (100 µM for 30 min) suppresses LPS-induced (1 µg ml −1 , 4 h) IL-6 ( c ) and TNF ( d ) release by human PBMCs. The values of the unstimulated controls were arbitrarily set to 1. For c and d , statistical significance ( P < 0.05) was assessed with a two-sided unpaired Student’s t- test (vs LPS-stimulated control). e , TMA (100 μM) or the IRAK4-specific inhibitor PF06650833 (50 nM) do not inhibit TNF secretion from human PBMCs after 4 h stimulation with PMA (50 ng ml −1 ) and ionomycin (1 μg ml −1 ). f , Impact of TMA pre-treatment (100 µM, 30 min) on human PBMCs’ Thr209 IRAK1/IRAK1 phosphorylation upon LPS (1 µg ml −1 ) stimulation for the indicated times. g , Human PBMCs were pre-treated (for 30 min) with the indicated concentrations of TMA, and Thr209 IRAK1/IRAK1 phosporylation was assessed after 10 min of LPS (1 μg ml −1 ) challenge. The time-dependent ( h ) and dose-dependent ( i ) effect of TMA on phosphorylation of Ser536 NF-κBp65/NF-κBp65 of human PBMCs stimulated with LPS (1 μg ml −1 ) was assessed as in f and g . For f – i , the control value was arbitrarily set to 1, and statistical significance ( P < 0.05) was assessed with a one-sided unpaired Student’s t- test. For PBMC experiments in c – i , each data point represents a separate experiment. j , A 24 h Kaplan–Meier survival curve of mice challenged with a lethal dose of LPS (30 mg kg −1 ) that received a single dose of TMA (59 mg kg −1 , red line), or vehicle (black line); * P = 0.0047 determined by two-sided log-rank Mantel–Cox test. Data are means; error bars, s.e.m.

    Journal: Nature Metabolism

    Article Title: Inhibition of IRAK4 by microbial trimethylamine blunts metabolic inflammation and ameliorates glycemic control

    doi: 10.1038/s42255-025-01413-8

    Figure Lengend Snippet: a , Kinome screen for a single dose of TMA (0.1 mM) against 456 kinases. The kinases covered by the kinome scan assay are visualized using a phylogenetic layout. Preliminary positive hits with potential binding >35% vs control (DMSO) are represented by a red dot; non-binding kinases are represented by a green dot. Kinase group names: TK, tyrosine kinases; TKL, tyrosine kinase-like; STE, STE kinase group; CK1, cell linase 1; AGC, protein kinase A, G and C families; CAMK, calcium and calmodulin-regulated kinases; CMGC, CMGC kinase group. b , Functional characterization of the inhibition of IRAK4 by TMA. IRAK4 phosphorylation activity was determined in the presence of various concentrations of TMA and resulted in an IC 50 of 3.4 µM. c , d , TMA preincubation (100 µM for 30 min) suppresses LPS-induced (1 µg ml −1 , 4 h) IL-6 ( c ) and TNF ( d ) release by human PBMCs. The values of the unstimulated controls were arbitrarily set to 1. For c and d , statistical significance ( P < 0.05) was assessed with a two-sided unpaired Student’s t- test (vs LPS-stimulated control). e , TMA (100 μM) or the IRAK4-specific inhibitor PF06650833 (50 nM) do not inhibit TNF secretion from human PBMCs after 4 h stimulation with PMA (50 ng ml −1 ) and ionomycin (1 μg ml −1 ). f , Impact of TMA pre-treatment (100 µM, 30 min) on human PBMCs’ Thr209 IRAK1/IRAK1 phosphorylation upon LPS (1 µg ml −1 ) stimulation for the indicated times. g , Human PBMCs were pre-treated (for 30 min) with the indicated concentrations of TMA, and Thr209 IRAK1/IRAK1 phosporylation was assessed after 10 min of LPS (1 μg ml −1 ) challenge. The time-dependent ( h ) and dose-dependent ( i ) effect of TMA on phosphorylation of Ser536 NF-κBp65/NF-κBp65 of human PBMCs stimulated with LPS (1 μg ml −1 ) was assessed as in f and g . For f – i , the control value was arbitrarily set to 1, and statistical significance ( P < 0.05) was assessed with a one-sided unpaired Student’s t- test. For PBMC experiments in c – i , each data point represents a separate experiment. j , A 24 h Kaplan–Meier survival curve of mice challenged with a lethal dose of LPS (30 mg kg −1 ) that received a single dose of TMA (59 mg kg −1 , red line), or vehicle (black line); * P = 0.0047 determined by two-sided log-rank Mantel–Cox test. Data are means; error bars, s.e.m.

    Article Snippet: Membranes were immunoblotted with antibodies against the following proteins: p Thr345/Ser346 IRAK4 (11927), IRAK4 (4363), p Ser176/180 IKKαβ (2694), IKKβ (8943), p Thr183/Tyr185 SAPK/JNK (4668), SAPK/JNK (9258), p Thr180/Tyr182 p38MAPK (9215) and p38MAPK (9212), all purchased from Cell Signaling Technology, and β-actin (sc-47778, Santa Cruz Biotechnology).

    Techniques: Binding Assay, Control, Functional Assay, Inhibition, Phospho-proteomics, Activity Assay

    ( a ) Confirmation of a physical interaction between TMA and IRAK4 using TMA at concentrations ranging from 0.1 nM to 100 µM, resulting in a dissociation constant ( K d ) of 14 nM. ( b – e ) Physical interaction test between TMA and the four hits identified using a kinome screen, using TMA concentrations ranging from 0.1 nM to 100 µM for ( b ) ANKK1, ( c ) HIPK2, ( d ) JAK2 and ( e ) NDR1. For (b-e) N = 2 biological repeats. IRAK4 kinase activity is not significantly inhibited by choline ( f ), TMAO ( g ) or DMB ( h ), while TMA does not have any inhibitory effect on IRAK-1 kinase activity (average of N = 2 biological repeats) ( i ). ( j , k ) Phosphorylation for pThr183/Tyr185 SAPK/JNK/SAPK/JNK ( j ) and pThr180/Tyr182 p38MAPK/p38MAPK ( k ) densitometric ratios, represented by each dot. Data are means ± s.e.m. One-way ANOVA followed by Tukey’s post hoc tests (superscript letters for factor levels P < 0.05) on log-transformed data. Source data are provided.

    Journal: Nature Metabolism

    Article Title: Inhibition of IRAK4 by microbial trimethylamine blunts metabolic inflammation and ameliorates glycemic control

    doi: 10.1038/s42255-025-01413-8

    Figure Lengend Snippet: ( a ) Confirmation of a physical interaction between TMA and IRAK4 using TMA at concentrations ranging from 0.1 nM to 100 µM, resulting in a dissociation constant ( K d ) of 14 nM. ( b – e ) Physical interaction test between TMA and the four hits identified using a kinome screen, using TMA concentrations ranging from 0.1 nM to 100 µM for ( b ) ANKK1, ( c ) HIPK2, ( d ) JAK2 and ( e ) NDR1. For (b-e) N = 2 biological repeats. IRAK4 kinase activity is not significantly inhibited by choline ( f ), TMAO ( g ) or DMB ( h ), while TMA does not have any inhibitory effect on IRAK-1 kinase activity (average of N = 2 biological repeats) ( i ). ( j , k ) Phosphorylation for pThr183/Tyr185 SAPK/JNK/SAPK/JNK ( j ) and pThr180/Tyr182 p38MAPK/p38MAPK ( k ) densitometric ratios, represented by each dot. Data are means ± s.e.m. One-way ANOVA followed by Tukey’s post hoc tests (superscript letters for factor levels P < 0.05) on log-transformed data. Source data are provided.

    Article Snippet: Membranes were immunoblotted with antibodies against the following proteins: p Thr345/Ser346 IRAK4 (11927), IRAK4 (4363), p Ser176/180 IKKαβ (2694), IKKβ (8943), p Thr183/Tyr185 SAPK/JNK (4668), SAPK/JNK (9258), p Thr180/Tyr182 p38MAPK (9215) and p38MAPK (9212), all purchased from Cell Signaling Technology, and β-actin (sc-47778, Santa Cruz Biotechnology).

    Techniques: Activity Assay, Phospho-proteomics, Transformation Assay

    ( a – d ) Effect of palmitate (PA; 200 μM) administration and TMA pre-treatment (0.1 mM, 30 min) in primary human hepatocytes at 0 and 60 min on pThr345/Ser346 IRAK4/IRAK4 ( a ), pSer176/180 IKKαβ/IKKβ ( b ), pThr209 IRAK1/IRAK1 ( c ), pSer536 NF-κBp65/NF-κBp65 ( d ) ratios. For (a-b) each dot represents densitometric ratios of relative phosphorylation levels from hepatocyte lysates from 3 independent biological repeats, treated as indicated. * p < 0.05 and ** p < 0.01 vs 0 min; † p < 0.05 and †† p < 0.01 vs vehicle; b p = 0.07 vs vehicle. Effect of PA (200 μM) administration (4 h) with and without TMA pre-treatment (0.1 mM, 30 min) on IL6 accumulation in hepatocyte media ( e ) and on pSer473 Akt1/Akt1 after insulin stimuli (100 nM, 10 min) ( f ). Each dot represents an independent biological repeat. *p < 0.05 and **p < 0.01 vs control-vehicle; †p < 0.05 vs control-PA. For (a-f) data are means ± s.e.m and statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc tests on log-transformed data. Source data are provided.

    Journal: Nature Metabolism

    Article Title: Inhibition of IRAK4 by microbial trimethylamine blunts metabolic inflammation and ameliorates glycemic control

    doi: 10.1038/s42255-025-01413-8

    Figure Lengend Snippet: ( a – d ) Effect of palmitate (PA; 200 μM) administration and TMA pre-treatment (0.1 mM, 30 min) in primary human hepatocytes at 0 and 60 min on pThr345/Ser346 IRAK4/IRAK4 ( a ), pSer176/180 IKKαβ/IKKβ ( b ), pThr209 IRAK1/IRAK1 ( c ), pSer536 NF-κBp65/NF-κBp65 ( d ) ratios. For (a-b) each dot represents densitometric ratios of relative phosphorylation levels from hepatocyte lysates from 3 independent biological repeats, treated as indicated. * p < 0.05 and ** p < 0.01 vs 0 min; † p < 0.05 and †† p < 0.01 vs vehicle; b p = 0.07 vs vehicle. Effect of PA (200 μM) administration (4 h) with and without TMA pre-treatment (0.1 mM, 30 min) on IL6 accumulation in hepatocyte media ( e ) and on pSer473 Akt1/Akt1 after insulin stimuli (100 nM, 10 min) ( f ). Each dot represents an independent biological repeat. *p < 0.05 and **p < 0.01 vs control-vehicle; †p < 0.05 vs control-PA. For (a-f) data are means ± s.e.m and statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc tests on log-transformed data. Source data are provided.

    Article Snippet: Membranes were immunoblotted with antibodies against the following proteins: p Thr345/Ser346 IRAK4 (11927), IRAK4 (4363), p Ser176/180 IKKαβ (2694), IKKβ (8943), p Thr183/Tyr185 SAPK/JNK (4668), SAPK/JNK (9258), p Thr180/Tyr182 p38MAPK (9215) and p38MAPK (9212), all purchased from Cell Signaling Technology, and β-actin (sc-47778, Santa Cruz Biotechnology).

    Techniques: Phospho-proteomics, Control, Transformation Assay

    ( a ) Indicative agarose gel of PCR products from +/-irak4 and -/-irak4 mice. ( b , c ) Body weight monitoring during the whole experiment of Irak4 −/− mice (N = 9) or wild-type controls (N = 9) ( b ) or PF06650833-treated (N = 9-13) or vehicle-treated (N = 6) mice ( c ) fed a LC-HFD. ( d ) Densitometric analyses of western blots in Fig. using β-actin to correct Akt levels prior to pAkt normalization. Each data point represents pAKT Ser473 /β-actin ratio from a single mouse liver. Data are means ± s.e.m. double-sided unpaired Student’s t test (* P < 0.05) on log-transformed data. Source data are provided.

    Journal: Nature Metabolism

    Article Title: Inhibition of IRAK4 by microbial trimethylamine blunts metabolic inflammation and ameliorates glycemic control

    doi: 10.1038/s42255-025-01413-8

    Figure Lengend Snippet: ( a ) Indicative agarose gel of PCR products from +/-irak4 and -/-irak4 mice. ( b , c ) Body weight monitoring during the whole experiment of Irak4 −/− mice (N = 9) or wild-type controls (N = 9) ( b ) or PF06650833-treated (N = 9-13) or vehicle-treated (N = 6) mice ( c ) fed a LC-HFD. ( d ) Densitometric analyses of western blots in Fig. using β-actin to correct Akt levels prior to pAkt normalization. Each data point represents pAKT Ser473 /β-actin ratio from a single mouse liver. Data are means ± s.e.m. double-sided unpaired Student’s t test (* P < 0.05) on log-transformed data. Source data are provided.

    Article Snippet: Membranes were immunoblotted with antibodies against the following proteins: p Thr345/Ser346 IRAK4 (11927), IRAK4 (4363), p Ser176/180 IKKαβ (2694), IKKβ (8943), p Thr183/Tyr185 SAPK/JNK (4668), SAPK/JNK (9258), p Thr180/Tyr182 p38MAPK (9215) and p38MAPK (9212), all purchased from Cell Signaling Technology, and β-actin (sc-47778, Santa Cruz Biotechnology).

    Techniques: Agarose Gel Electrophoresis, Western Blot, Transformation Assay

    a – h , Irak4 −/− mice and wild-type (WT) littermates (5 weeks old) were fed a LC-HFD ( n = WT HFD and n = 8 Irak4 −/− HFD) and were phenotyped after 8 weeks. Each point represents data from a single mouse. a , Plasma glucose concentration during an ipGTT. Two-sided Student’s t -test (* P < 0.05). b , Area under the curve of the plasma glucose concentration during an ipGTT. c – e , Circulating cytokines IL-6 ( c ), TNF ( d ) and IL-1β ( e ). f – h , Liver mRNA expressions for Saa1 ( f ), Saa2 ( g ) and Saa3 ( h ) genes. For b – h , data are means; error bars, s.e.m. Statistical significance ( P < 0.05) was determined using a one-tailed Mann–Whitney test. i – n , Mice were weaned at 3 weeks and fed a LC-HFD before being fitted with osmotic minipumps delivering a chronic circulating dose of PF06650833 (50 nM) for 6 weeks. i , Plasma glucose concentration during an ipGTT. Each point represents data from a single mouse. j , Area under the curve of the plasma glucose concentration during an ipGTT. k , Plasma glucose concentration during an ipITT. l , Area under the curve of the plasma glucose concentration during an ipITT. m , n , Western blot analysis of liver Akt phosphorylation. A representative immune blot from n = 3 repeats is shown. Data are means; error bars, s.e.m. For i – n , P values were determined by one-sided unpaired Student’s t- test ( P < 0.05 was deemed statistically significant). For n , the data were log transformed.

    Journal: Nature Metabolism

    Article Title: Inhibition of IRAK4 by microbial trimethylamine blunts metabolic inflammation and ameliorates glycemic control

    doi: 10.1038/s42255-025-01413-8

    Figure Lengend Snippet: a – h , Irak4 −/− mice and wild-type (WT) littermates (5 weeks old) were fed a LC-HFD ( n = WT HFD and n = 8 Irak4 −/− HFD) and were phenotyped after 8 weeks. Each point represents data from a single mouse. a , Plasma glucose concentration during an ipGTT. Two-sided Student’s t -test (* P < 0.05). b , Area under the curve of the plasma glucose concentration during an ipGTT. c – e , Circulating cytokines IL-6 ( c ), TNF ( d ) and IL-1β ( e ). f – h , Liver mRNA expressions for Saa1 ( f ), Saa2 ( g ) and Saa3 ( h ) genes. For b – h , data are means; error bars, s.e.m. Statistical significance ( P < 0.05) was determined using a one-tailed Mann–Whitney test. i – n , Mice were weaned at 3 weeks and fed a LC-HFD before being fitted with osmotic minipumps delivering a chronic circulating dose of PF06650833 (50 nM) for 6 weeks. i , Plasma glucose concentration during an ipGTT. Each point represents data from a single mouse. j , Area under the curve of the plasma glucose concentration during an ipGTT. k , Plasma glucose concentration during an ipITT. l , Area under the curve of the plasma glucose concentration during an ipITT. m , n , Western blot analysis of liver Akt phosphorylation. A representative immune blot from n = 3 repeats is shown. Data are means; error bars, s.e.m. For i – n , P values were determined by one-sided unpaired Student’s t- test ( P < 0.05 was deemed statistically significant). For n , the data were log transformed.

    Article Snippet: Membranes were immunoblotted with antibodies against the following proteins: p Thr345/Ser346 IRAK4 (11927), IRAK4 (4363), p Ser176/180 IKKαβ (2694), IKKβ (8943), p Thr183/Tyr185 SAPK/JNK (4668), SAPK/JNK (9258), p Thr180/Tyr182 p38MAPK (9215) and p38MAPK (9212), all purchased from Cell Signaling Technology, and β-actin (sc-47778, Santa Cruz Biotechnology).

    Techniques: Clinical Proteomics, Concentration Assay, One-tailed Test, MANN-WHITNEY, Western Blot, Phospho-proteomics, Transformation Assay

    TMA is synthesized from dietary choline (1) by the gut microbiota (2) and specifically inhibits IRAK4 activity (3). This inhibition blunts the TLR signalling pathway (induced by LPS and saturated free fatty acids), leading to an improvement of metabolic response to HFD (for example, glucose homoeostasis). Image adapted from Servier Medical Art ( https://smart.servier.com ), licensed under CC BY 4.0 ( https://creativecommons.org/licenses/by/4.0 ).

    Journal: Nature Metabolism

    Article Title: Inhibition of IRAK4 by microbial trimethylamine blunts metabolic inflammation and ameliorates glycemic control

    doi: 10.1038/s42255-025-01413-8

    Figure Lengend Snippet: TMA is synthesized from dietary choline (1) by the gut microbiota (2) and specifically inhibits IRAK4 activity (3). This inhibition blunts the TLR signalling pathway (induced by LPS and saturated free fatty acids), leading to an improvement of metabolic response to HFD (for example, glucose homoeostasis). Image adapted from Servier Medical Art ( https://smart.servier.com ), licensed under CC BY 4.0 ( https://creativecommons.org/licenses/by/4.0 ).

    Article Snippet: Membranes were immunoblotted with antibodies against the following proteins: p Thr345/Ser346 IRAK4 (11927), IRAK4 (4363), p Ser176/180 IKKαβ (2694), IKKβ (8943), p Thr183/Tyr185 SAPK/JNK (4668), SAPK/JNK (9258), p Thr180/Tyr182 p38MAPK (9215) and p38MAPK (9212), all purchased from Cell Signaling Technology, and β-actin (sc-47778, Santa Cruz Biotechnology).

    Techniques: Synthesized, Activity Assay, Inhibition